Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ668452
Length 144 bp
Fasta Format > whkv14p14
ctgcctttgacccctttgccgaggcgaatgctggggacgctggtgcanct gccggatcanaagactacnntcatgtacgcatccagcagcgtaatggtcg caagagcctgaccactgtccagggtctgaagaaggagttcagct
Download
page-top