Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ668154
Length 758 bp
Fasta Format > whkv13n17
aagaggaggaagaacaccaaggactcactaccagcgcctctccgcgatcc aaatcctcccgggaaagatcttggttgatctcttcctcctcgaccgcctc ccaggttcttggtgcagcttttgccagtctcagcaggagatttcatgtct gatcttgacgttcagatcccaactgcctttgacccctttgccgaggcgaa tgctggggacgctggtgcagctgccggatcaaaagactacgttcatgtac gcatccagcagcgtaatggtcgcaagagcctgaccactgtccagggtctg aagaaggagttcagctacagcaagatcctcaaagacctcaagaaagagtt ttgctgcaatggtacagttgtccaggacacagaacttggacaggtcattc aactccagggtgatcagaggaagaacgtctcaaacttccttgtccaggcc ggcattgtgaagaaggaacacatcaagattcatggtttctgagcaactgc cagctccatatcagagtctacatgcaaagcagctatatattggtggtgca gtatatttagttgtgtgctagcgctagcaggcgttaccagcttgcgcgct ctgagtatacagaaaatctagcatagcccacctctctgcgtgtatgcttg ttaccgttgtgttgaaactttgtaaggagcaccatctttagatggcttgt taccctctcccatcaaggttgaataatatatgctttgttaagcgtggtaa aaaaaaaa
Download
page-top