Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ668135
Length 403 bp
Fasta Format > whkv13m20
agctcgctgaggcggatgagttcgaggacaagatgaaggagctggaggcc ctgtgcaaccccatcatcgccaagatgtaccagggtgctggtgccgacat ggagggcggcatggacgacgacaccccagctgcatccggcggccctggcc ccaagatcgaggaggtcgactaaacagtcagttgttctgttgcagaggcg gcgaagcctgctgcttattataccgtgtctgtgttatctgagacttgagg ttgtggtggttattgttttgcttccgagtggtcggagttattccgtgcga gttgcaacattcgtggtagtggatcaagggttatgatgtctcacgtctaa gtatattattagtttgttggtatttctactgtacctttatattaaaaaaa aaa
Download
page-top