Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ668070
Length 812 bp
Fasta Format > whkv13i24
ccgccgcagccgcctcctgctacccgccgccgagatgacgaagcgcacca agaaggccggaatcgtcgggaagtatggtaccaggtatggtgccagtttg cgtaagcagatcaagaagatggaggtgtctcagcactccaagtacttctg tgaattctgtgggaagtttgctgtgaagaggaaagctgttggaatttggg gatgcaaggactgtggcaaggtcaaggctggcggcgcctataccatgaac actgctagtgcagtcaccgtcaggagcacgatccgtcgcttgagggagca gaccgaagcatgattgccctactgttgtcttgaggaatccaggggttctg tagtggagtgaagacttaacaatctctgtattttggctatcgagcgatgg atatctgttagtaattttggttctgattttaggatctttgaaacttgaaa gtatgtccctacagctgcctgttatgcgttatgccaacctatttgtattt ttgtgacacgtctctccctcgtgccgaattcggcacgagggcatcctcct ctcctccagataatacattaccatggcccccgccgtgatggcttcctcgg ctaccaccgtcgcacccttccaggggctcaagtccacagccggtctcccc gtcggccgccgctccancggcagcctcancancgtcancaatggcggaag gatcangtgcatgcangtgtggccaattgagggcatcaanaanttcnana ccctgtcttacctgccacccctatccacngangccctcctgaaacangtc nactacctgatc
Download
page-top