Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667558
Length 707 bp
Fasta Format > whkv11k22
tacggccggcagggccgggcagggcacactccgttatccaatccggcgtc cgtgcacgcagcgcacaccatgtaggccacaagatctcagatagcttatg tcatggtggtggcataagctaccagtaccagctgcatgcctgtgctcttc ttcaattggaggcttggagtgtgccctgggccggccatggcccatgggcg cgtacgtagcagccgatggatccggcgttggctagctatctctggcctac atcaagctgcagctggctaggctacttgggttcttgaggaagctcggggt gaaacggccatggctggccggcagggcggcctcgtccacggcggcggcgg cgacttctcacctctactaaggtagggcaacttctatcctttggcaattg taacttctcgatcggggagcgtgatgatctctctcctgtgagtaccggtg acgatcatagcatggtgcgagtcttcagtgtcgtgtaactactagtagct agctataccaaattgatatgaagctagctagtggtagctagtatgggtgt gtgtgtatgatcctgcttgaatccttcnattctgctatctatgggcagtg tatttgttgagttttgtatctggtaatatctcttttgttaaccccngccg tatattgactantgtaatcatcaataaatataatttgatatgtatgcaaa aaaaaaa
Download
page-top