Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667501
Length 756 bp
Fasta Format > whkv11h08
gagcccgtgacaagtttgtttctctcccgtagtcccacactcgaacgaga tggctgacgagtacggccgcggcggctacggcaggtccgctgccggcgac gactacgacaacaagaccagcaacgagggctacgaccgccgagaaggtgg ctacaacaagtccggcgccgacgactacgagcacgagcgcagcagcggcc gcggtggctacaacaagtccaccggcgacgacgagtacagcggcgccggg tacaagaagtccggaggcgacaactacgacaccggttacaacaagcagtc cagcaacgaggagtacggccgcaacaagcccggcagcgacgactacgacc gcagcgccggcgggtacaagaagtccggcgacgatgagtacagcggtggc gggtacaagaaggcgggtggcgacgacgagtacagcggtggcgggtacaa gaagtcggggggcgacgacgagtacagcggcggcgggtacaagaagtccg gcggcgacgacacagagtacgggtcgtccagggacgagaccgagaagtac aggaaggaggagaaggagcacaagcacaaggagcacctcggcgagatagg caccctcgcctccggcgccttcgccatggggccatgtatatatggatgtg tgtagtacganaagcaccangtgaagaaggacccggagaacgcgcaccga cacaagatcnangangangtggccgcngtggcggccgtgggcancngcgg ttacnc
Download
page-top