Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667498
Length 503 bp
Fasta Format > whkv11h04
gcacgacctacngacacctgctcacctccatgaggaccatcatgcgcaac ggcggcggcaactgcaacctgcagggccccgccggcggctgcatccgcaa ggtggccaacttcagcggggtggagganccccagctgtcttctgcttgca agtttgacatccaccgcgagccgttctgcatgtagaacccgcgcccgggt tcgtcgtcgttctgcactcgacgattaccacctacacggctaatcatcga ccgtatcgagatagccgatcagtgggataaataactatgacgctttctgc tagtatgtgtgatagccgatcacctcacctgccgcaatgccatccagaat gagcatagctcacacaaggctctggaggacctccttccctactgtattgt acgtctgtatgtacgtacctcattgtaataaggttgtggtggtgttgtgt gtcgtctcatacgtacccttataaataaatcaagttctatgccaaaaaaa aaa
Download
page-top