Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667485
Length 771 bp
Fasta Format > whkv11g13
agcaacttcttcagccaccaattattgcctctgtctttgcaattggaatc ggtgttgttccattcttgaagggtttgatattcacggatgatgcacctct attcttcttcacagacagctgcctcattcttggggaagctatgattccat gcattttgcttgctgtggggggtaatcttgttgatggtcctggtgaaggg agtaaaagacttggtgtgcggaccaccgttgctattatttttgcacggtt gatcttggttccaattgctggggttggcatcgtcatgctagttgacaaac ttggtttcattcccaaagatgacaaaatgttcaagtttgttctactactg cagcattccatgcccacatctgtgctctcaggtgccgttgcaaacttgag agggtgcgggaaagaatcggccgcgatcttgttctgggtgcacatttttg cagtgttctccatgacgggatggattattttctatttgacgctgctcttc taaatactgcactcaacttgaatatccgcaaatagtagataccatcagaa aacatggaagaagataatagtgtgtcctgaactgtacaatagccactgaa accatggtggcagctgctctggaggtacgagttgtatcggtacagatatg ggttcctcgtaccctgtttgtgtaaatgcttttgtcatgttaattttggc ctcgtctctccgccgcgagaagcgacgagtgacgagaatcgcggcagctg tggtgcctgcccatattatta
Download
page-top