Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667481
Length 857 bp
Fasta Format > whkv11g06
gttttttcagtgtgtcgatttgcctaactatgccttgttgattactgatt ttgttactaatgtgtacacaaaccctgcctaattaatttagtccactata tctaaccatatgaaagtgaaagttgattctgactacttgcctggtggtac ggtacattacctctttttcaaattatgagagcggaacgacagcgttggcg tggacgactcggagctcaaccccgtcaagggccgcgagcaggagcggctt tcttttcaacaagaagatgaccaaggtccaagggcgccgccagccacttt gtcgttgtcatcgaagagtccaagattgtccccgcatcggttgcattggt gccgatcaggtccaggtctgcgcggttggggcgtcaatcacgtgttcagc ggcatgtcagagcaactctctggccagaaccctgactatgtgcgcttcag ggaaatgtggacgctggatatccatttcttaggtgtcaatctggtactta ggctgtgtaatacagggcagagttcttccagctactaattcacgtaatct gatttatagcctaggcacttttctttaagcatagttacctattcgatggt gaccaaccatccgtcacacgcgccatacaaacaattcaggaggaggcccg cttgtgagcatgcgccggcgccaaaggccttgcggtcatcatcccggaga cgcagtcctggtccatcgtgggaggcgcttccacagagatccatgcgtcn aggcagcttactcatgccatccatgcgcacatgcttgtangcggcctttt gttgcggcatatatcctgtaacaactaaaccctgtattttcacactctcc tatcaat
Download
page-top