Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667420
Length 574 bp
Fasta Format > whkv11c14
taccagctgcatgcctgtgctcttcttcaattggaggcttggagtgtgcc ctgggccggccatggcccatgggcgcgtacgtagcagccgatggatccgg cgttggctagctatctctggcctacatcaagctgcagctggctaggctac ttgggttcttgaggaagctcggggtgaaacggccatggctggccggcagg gcggcctcgtccacggcggcggcggcgacttctcacctctactaaggtag ggcaacttctatcctttggcaattgtaacttctcgatcggggagcgtgat gatctctctcctgtgagtaccggtgacgatcatagcatggtgcgagtctt cagtgtcgtgtaactactagtagctagctataccaaattgatatgaagct agctagtggtagctagtatgggtgtgtgtgtatgatcctgcttgaatcct tcgattctgctatctatgggcagtgtatttgttgagttttgtatctggta atatctcttttgttaaccccggccgtatattgactagtgtaatcatcaat aaatataatttgataaaaaaaaaa
Download
page-top