Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667407
Length 815 bp
Fasta Format > whkv11b12
atatgtgatggagcatcacctctgtacaagggtcaagttcttgcggtcgt tggaggaggtgatacagctaccgaggaagcgatatatttgacaaaatatg cgtgccatgttcatttacttgttcgaagggaccaactacgagcatccaaa gctatgcaggaccgagtactcaacaaccccaacataacagtacatttcaa tacagaagctgtggatgttgtcggcaataccaaaggacagatgtctggta ttcagttgaggagaatcgatacgggagaggaaaaagttcttgaagtgaaa ggtctattttatgggataggacatactccaaacagtcagctgctacaagg tcaaattgaacttgatagttctggatatattttggttgacgaaggcacag caaaaacttcagttgatggcgtatttgctgctggtgatgtgcaggatcat gaatggaggcaagccgttactgcagctggatctggatgtatagctgcttt gtcagttgaaagatacttagtctccaatgatcttcttgttgaatttcacc agcctgttcgtgaagaaaaaaagaaggagattgaaggcaaagatgtcgag atgggcttcgacattactcacacaaagcacaagggacagtatgcactccg caagttataccatggaagtccaaggctcatcttggttctatatacttctc caacatgtggtccctgcagaaccttaaaaccgattttgaacaaggttata gatgaatatgacgaatacgttcattttgttgaaattgacatcnaggagga ccctgaaatancana
Download
page-top