Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667390
Length 822 bp
Fasta Format > whkv11a11
gacatatgatccaaatgccccaactcaacatactcggagcaattcatcga cccctagggccagaaatgttggtgggcggaacagcgaacagcgcaacgga cgctcaccaaatcatcattctcctaggacatcaaagcacggaggggaggt cagccggactagttctactggtggtgattctggccggaggtcaggattgg atgaaatggacatggcaggatcacaggcaggcagcccagcacagacagga aggaagagagaaacccccaggaccgctgacaggcagcgcgccattgcgga cgctaaaatgtggggggagaactccagagagcggaagcgaccgaacgaca gctttgatagtacaaatgagtaaactggacagttctctttcacgacgtca ctctagcagggggtcgacgagtttgctcatcagcaccagacgggccaggt ttaggaacacggtgtttgttccagctctgtcccgttgtctgtgaataaag gcttttcttgccatcagcactgcctcacggttgctttatctgtaagttgt tgcagttgacatgccttctccgggcggcgtccattccttgcgaatgtgat tgtgtcatgtactcgtctcctttanagctcangagcctacaagatgcanc tggaaatgtangaaagggaactgcaagaccgtcnaagccgcanagctgcg tctgtcangcccttcctttcattcttctgcanttacacnatgtcnacnan tacncaccgctgcacctgtgttctggaactgattgcncaaccgtgccang cantttcttctgatggatgana
Download
page-top