Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667385
Length 768 bp
Fasta Format > whkv11a01
cagccaagaaccaatacttgatctgttgttttctttagctcccggaagac cttttagctgcaccgatcgatctcgatcatggaggatgagaggagcaccc agtcataccagggaggtgaggccgccgagcaggtggaggtgacagacagg ggcctcctcggcaacctcctcggcaagaagaaggcggaggaggacaagga gaagcaggaggagctggtcaccggcatggagaaggtctccgtggaagagc ccgaggttaagaaggaggagcacgaggatggcgagaagaaggagaccctc ttctccaagctgcaccgatccagctccagctccagctcgtctagtgacga ggaagaggaggaggtgatcgatgacaacggtgaggtgatcaagaggaaga agaagaagggtctcaaggagaagctcaaggagaagctgcccggccacaag gacaccgagggtgagcacgtgacgggcctacccgcaccggcggcccccgc gtctgtgcagacccaccatgacaccgacgtcgtcgtcgaaaagatcgacg gtgacgtgaagacagaggcggcaccggcagtgcccgaggaggagaagaaa ggcttcttggaaaagatcaaggagaagctgcccggcggccacaagaaacc ggaggacgctgctccggtgcccgtcacgcacgctgctccancaccantgc acgcgccggcgccagccgccgaggaggtgagcanccctgacnccanggan aattgaatgttgcanaat
Download
page-top