Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672424
Length 739 bp
Fasta Format > whkv9n14
tcttggagattgcccaagtccctgatgagcatgtgaatgaattcaagtcg attgagaagttcaagatatttaacaccaacaacctgtgggtgaacttgaa ggcgatcaagaggcttgtagatgctgaagcacttaagatggaaatcattc ccaaccctaaggaagttgatggcgtgaaagtcctgcagctagaaaccgca gctggagcagcgatcaggttctttgagaaagcaatcggcatcaacgttcc ccgctcaaggtttctgcccgtgaaggctacatctgatttgttgcttgtgc agtctgatctctataccttggttgatggctacgtcatccgcaacccagcc agagtgaagccatcgaacccttcaattgagcttggtcctgagttcaaaaa ggttgccaacttccttgcccgtttcaagtcgatccccagcatcgttgagc tcgacagcttgaaggtctctggtgatgtctcgtttggctctggagtcgta ctcaagggcaacgtgaccatcgctgccaaggctggagtcaagttggagat cccagacggagctgtgctcgagaacaaggacatcaacggccctgaggatc tttgagcgacgcccgccgccatcgccagtcgcattcccagaaaccttccg gtcctccttcnctgagttaaccgtcctgtaattttcgtgtgcattctgct ggggtgttgtcctgnnatancccctttacataataattg
Download
page-top