Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672395
Length 815 bp
Fasta Format > whkv9l14
tagggctcgcgagttctccgcctcgtctcatctccccctctttaccgaca cgacccggcggccaaatttagggttttgctcccgcaatcttcccccggag ccgccgcctccttcccgccccggcggcgatccagctcggcgtctccatcc gccgatccggactttttttcaatctccggatctcgctcaagatgcttccc ctctcgctcctcaagaccgcccaggggcatcccatgctcgtggagctcaa gaacggcgagacctacaatgggcacttggtgaactgcgacacgtggatga acatccacctccgggaggttatttgcacctctaaggatggtgataagttt tggaggatgccggagtgctatattcgtggtaacacgatcaagtatcttcg ggttcctgatgaggtgattgacaaggttcaagaggaaacttctaagagta gatcagataggaagccaccaggtgttggtcgtggaagaggaagaggagat ataggcactaaacctggaggcagaggcattggtcgtggccaagatgatgg caaaggcggtggccgtggaaggggcggaattggaagtaaaggtggcaaca aaggcggacgtggtcgtgggtaagacggatcttgagatgcgagaatgccg ctttttaaggcctgtagttgtggtgttgcatanattgcttaggacatgaa aaactttggagctggaattgctgggttttgcggtatggtatggcaaaacg gtttgtgtggtatgaanttaccnaggnagttggatgtcctaatattttgg gtatgggcattatgc
Download
page-top