Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672351
Length 419 bp
Fasta Format > whkv9h20
gttaccactgnttagctatgagctggatgatgccgaatacggggaaaatg aggtgaatgacccatgggtgcagaagcttctccttgcagttgacactaat gttacatggctccagccaatgatgacatcgaacaactacgattcttttgt gcacctggtcatcgacttcattgtcaagaggcttgaggttatcatgatgc agaagaggttcagccagctcggtggcctgcagctcgacaaggaggttcgc tccctaatcaaccatttctcggagatgtcacagaggccagtgcgagacaa gttctcgaggctttcccagatgtcgaccatcctgaacttcgagcgcgtgt ctgagatactggacttctggggtgacaatgctgggcatctgacatggctg ttgacacctgcggaggtga
Download
page-top