Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ672246
Length 708 bp
Fasta Format > whkv8p21
gtacggccggcagggccgggcagggcacactccgttatccaatccggcgt ccgtgcacgcagcgcacaccatgtaggccacaagatctcagatagcttat gtcatggtggtggcataagctaccagtaccagctgcatgcctgtgctctt cttcaattggaggcttggagtgtgccctgggccggccatggcccatgggc gcgtacgtagcagccgatggatccggcgttggctagctatctctggccta catcaagctgcagctggctaggctacttgggttcttgaggaagctcgggg tgaaacggccatggctggccggcagggcggcctcgtccacggcggcggcg gcgacttctcacctctactaaggtagggcaacttctatcctttggcaatt gtaacttctcgatcggggagcgtgatgatctctctcctgtgagtaccggt gacgatcatagcatggtgcgagtcttcagtgtcgtgtaactactagtagc tagctataccaaattgatatgaagctagctagtggtagctagtatgggtg tgtgtgtatgatcctgcttgaatccttcnattctgctatctatgggcagt gtatttgttgagttttgtatctggtaatatctcttttgttaaccccngcc gtatattgactantgtaatcatcaataaatataatttgatatgtatgcaa aaaaaaaa
Download
page-top