Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ671428
Length 809 bp
Fasta Format > whkv5o04
atacattaccatggcccccgccgtgatggcttcctcggctaccaccgtcg cacccttccaggggctcaagtccacagccggtctccccgtcggccgccgc tccagcggcagcctcagcagcgtcagcaatggcggaaggatcaggtgcat gcaggtgtggccaattgagggcatcaagaagttcgagaccctgtcttacc tgccacccctatccacggaggccctcctgaaacaggtcgactacctgatc cgctcaaagtgggtgccctgcctcgagttcagcaaggttggcttcgtctt ccgtgagcacaacagctcccccgggtactacgacggccgatactggacaa tgtggaagctgcctatgttcgggtgcactgacgccacacaggtgctgaac gaggtggaggaggtcaagaaggagtaccctgacgcctatgtccgtgtcat cggcttcgacaacctgcgccaggtgcagtgcgtcagcttcatcgccttta ggccaccgggttgcgaggagtccggcaaggcctaaactacgagttgaaac aatggcctatctcgtatgaaggtcttttgtgaacttcacttttgtccaaa actctgctgtacgactctgctttctgaccggagcataccttttgttctat atgattttgtgtatgtatgtacgaacataggttcttgagcatgcatacgt aattcctcataggtctatatcttcttcttcggcacaacccccgaatacat caatggacganatctgtctataccttttcataataaagagtangatggtc tttcaagaa
Download
page-top