Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ671427
Length 666 bp
Fasta Format > whkv5o03
agcttagcacagcaccaatggcgtcggagcagaccttcatcatgatcaag cctgatggcgtccagaggggcctcatcggtgaggtcatcagccgcttcga gaagaagggcttctacctcaaaggtctgaagctccagaacgtggagaagt cgttcgccgagcagcactacgccgatctgtcctccaagcccttcttcgct gggctcgtggagtacatcgtctccggccctgtcgtcgctatggtctggga gggcaagagcgtcgtctccactggacgcaagataattggcgccaccaacc ccctggcctctgagcccggcaccatccgtggtgactttgccgtcgacatc ggcaggaacgtcatccatggaagcgactcagttgagagtgcgaggaagga gatcgccctgtggttccctgagggcattgcagagtggaggagcagccagc acaactggatctatgaggcctaagatgtgtcatgagtggttgagtgcagg tttcattaagcatctaccaaactagtctttggttgtttacagttttgaga tttgtatcttgggaaccttgtttgtgtgaactgaagttatctccttgtgc ttgggcatccaagcggtatctgctgctctatatttgatatatggtattgc tttgataaaaaaaaaa
Download
page-top