Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ671142
Length 808 bp
Fasta Format > whkv4n16
aatcttcgccactggtattgctgtcgatgatgctacagatgctgctcgaa gtgcttccgacattgtgcttaccgagccaggtctcagtgtcattatcagt gctgtcctgaccagcaggtgcattttccagaggatgaagaactacacgat ctatgcagtttccatcaccatccgtattgtgcttggctttatgcttattg ccttgatctggaaatttgatttcgcccccttcatggtccttatcattgcc atcctcaatgatggtactatcatgacaatatccaaggacagagttaagcc atctcccttgcccgacagcgagtttgagatgatgtctgcactgtacctcc aagtcagtattgtgagccaggctcttatattcgtgactcgttcacgcagc tggtcctttgttgagcgccctggtttcctcttggttaccgccttccttct tgcacaattggttgcaacactcatcgctgtctatgccaactgggagtttg caaggatcaagggaatcgggtggggctgggctggtgttatctggctcttc agcattgtgttctacttcccacttgacattttcaagttcttcatccgatt tgtgctgagtggaagggcctgggacaacctcctgcagaacaagactgctt tcaccaccaaagagaactacggcaaaggggagagggaagcacaatgggct actgcacagagaacactccatggccttcaagcacccgagccggcctccca cacactgttcaacgacaagagcagctaccgtgagctctctgagattgctg agcaagca
Download
page-top