Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ670957
Length 596 bp
Fasta Format > whkv4d18
cttccatcgcctcccaagatcgcagatctgctccggtgagaatccgtcgc catgtcttccagcgaggtcgcctgcacccttgccgccctcatcctccacg atgacgggatccccatcacttctgagaagatcgcgacggtggtgaaggct gccggaatcaaggttgaggcctactggcccgcgctcttcgccaagctcct ggagaagaggagcgtcgatgacctcatcctttccgtcggatctggtggag gtggtgctccagctgctgctgctgctgccccggctgctggtggtgctgct gccgctgaagagaagaaagaagagaaaaaggaggaggctaaggaagagag cgatgatgacatgggcttcagcttgttcgactaagcagttcaattccagt tctcctgtggaatcttttatgctaaggattacttatcttatgtgctttta ggtcgaattttgcggatttaatatgtttgagacctaagtatctgtgcaat gagtactgcaaaccaccttgggatggtctttttagaatgaaaatggtttt ggtgcttggttgaaaagccattgcttgttttaccctanaaaaaaaa
Download
page-top