Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ670851
Length 349 bp
Fasta Format > whkv3o11
gcccgacncgatggctcccaccatgaaggcgaagaagagcggggagaaca tcaacnanaagctgcagctggtgatgangagcggcaagtatacgctcggc tacaagaccgtcctcaagacgctgcgcagctccnaggggaagctgataat cctcgcaaacaactgcccgcccctgaggaagtcagagattgagtactacg ctatgttggcgaaaattagcgtgcaccatttccatggaaacaatgttgat cttggaacagcctgcggcaagtactaccgggtgtgctgcctcagcatcct tgaccctggtgactcggacatcatcagcaccaccaccaccacccantga
Download
page-top