Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ670609
Length 768 bp
Fasta Format > whkv3a06
ccccccggctccaatggcggcgaaggaaccgatgcgcgtgctcgtcaccg gcgccgcaggacaaatcggatatgctcttgttcccatgattgccagggga gttatgcttggtgcagaccagcctgttattctgcatatgctggatattga atttgctgctgaagctcttaaaggcgtcaagatggagttgatcgatgccg catttccacttctcaagggagttgttgcaacaactgatgttgttgaggct tgcactggtgtgaatgttgcggttatggttggtggattccccaggaagga aggaatggaaaggaaggatgttatgacgaaaaatgtttcaatctacaaag ctcaagcatctgctcttgaagctcatgcagcccccaattgcaaggttttg gttgttgccaacccagcaaacaccaatgctctcatcctgaaggagtttgc tccatctatccctgagaagaacatcagttgtttgacccgcctagaccaca acagggcactcggtcagatttctgagagacttggtgtccaagtttctgac gttaagaatgctattatctggggtaatcactcgtccagtcagtatcctga tgttaaccatgccactgtgaagactcccagtggagagaagcctgttcgtg aacttgttcaagatgatgaatggctaaatggggagttcattgccactgtc cagcagcgtggtgctgcaatcatcaaagcgaggaagctctccagtgctct ctctgctgccagctcanc
Download
page-top