Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ670364
Length 765 bp
Fasta Format > whkv2c24
aacttctggagagggtggcttacatcaacaccattgtttatccattaaca tccctcccacttatcgcctattgtgtgcttcctgctatctgcctcctcac caacaaatttatcatccccgagatcagtaattatgctgggatgttcttca ttctcatgtttgcctccatctttgccactggtatattggagctccgatgg agtggtgtcggcatcgaggactggtggagaaacgagcagttctgggttat cggtggcacatctgcccatcttttcgcggtgttccagggtctgctcaagg tgctggccgggatcgacaccaacttcactgtcacatccaaggcgaacgac gaggacggcgacttcgccgagctatacgtgttcaagtggaccagtctcct gatccctccgaccaccgtcctggtcatcaaccttgtgggcatggtggccg gcatatcatacgccatcaacagcggctaccaatcctggggcccgctcttc ggaaagctcttcttctcgatctgggtgatcctccatctctaccccttcct caagggtctcatgggaaagcagaaccgcacgccgaccatcgtcatcgtct ggtccatcctcctcgcctccatcttctccctcctgtgggtgaagatcgac ccgttcatatccgacacccagaaggccgtcgccatggggcagtgcggcgt caactgctgatcggatcatcggcgctcaagagtatctgcccccctcgtgt aaataccggaggggg
Download
page-top