Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ670332
Length 154 bp
Fasta Format > whkv2b10
cgatggatncggcgttggctagctatctctggcctacatcaagctgcagc tggctaggctacttgggttcttgaggaagctcggggtgaaacggacatgg ctggccggcagggcggcctcgtccacggcggcggcggcgacttctcacct ctac
Download
page-top