Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ669925
Length 179 bp
Fasta Format > whkv1i21
agttcagttgcttattctgtcctgtctgcacacactgtagcagcaatatg ggtggcaaggttcttctgatgagtgccgtcttggtggggcttgtttcact gagctcgctgcaggagcctgggagagttgcatgagcagaanacccactat gggggctcaccaactcccncgcatgggtc
Download
page-top