Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ667372
Length 806 bp
Fasta Format > whkv10o16
ctctccgccgccgcttcctcatctcatcctcccggatcgggaggcggaag ccaagccccaagaaacttaaattctcggtgtgatattcaaaagcagtcaa gatggtgaagtttaccgcggaggagctccgtggaattatggacaaaaaga ataatatccgtaacatgtctgttattgctcatgttgaccatggcaaatct acgcttacggattcccttgtggcagcagctgggattattgcccaggaagt agctggtgatgttcgcatgaccgatacccgtgcagatgaggcagaacgtg gtattacaatcaaatccacgggtatctctcttttctatcagatgactcct gaatcacttgagatgtacaagggcgacagggatggtgatgagtacctgat caaccttattgattcacctggccacgttgacttctcttcagaagtcacag ctgctcttcgtatcaccgatggtgctttggttgttgttgactgtattgag ggtgtctgtgtgcagactgaaactgtgctgcgccaagctcttggtgagag gattcggcctgtcctcaccgtgaacaagatggacagatgcttccttgagc ttcaagtggaaggtgaggaagcatatcagactttctcccgtgtcattgaa aatgccaatgtcatcatggcaacatatgaagatgtgctccttggtgatgt ccaagtgtacccagagaaggggactgttgcattctccgctggtttgcatg ggtgggctttcacccttacaaactttgctaagatgtatgcctccaagttt ggagtt
Download
page-top