Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557613
Length 554 bp
Fasta Format > rwhkp20m11
ataacagaagctaaaatataaaccgacaccctggggtttagattactaga tacacacacaaacacacattgttgcctcgattgtttcctctccaccgatc aacccacgctacgcatgcacacaagatgagtatcttcacttctgctctgc tctagttagactcgagctgcgcgtaccacacaccctggatcttgacatcc ttgggcgccttggcgccgaggtcggtgtctgacggctgcacgctctcgaa gacgccgatcacctcgccggtctccggcttgctcttggtgacgctgagcg tgatgttgcccgtggaggaggacgcgttcttcacgttctccttggccaac tcctcctcgtctcctctgcctccggcgggtagcgccacggcgttgtcgta nccagtagagccaccacggccctttgggtngaggaaagacgaacccctgt anctggncacgaggaagggcccgctgaanctctcgggcttgncggtggcn acnanctgcttgacggagaagaggaagggnacgcgctcncctcnggggag ctga
Download
page-top