Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557542
Length 386 bp
Fasta Format > rwhkp20i18
aaccgcacaccctggggtttagattactagcatacacaacacaaacacac ngttgcttgcctngattgtttcctctccacngcatcaacccacgatacgc atgcacacnagcatgagtatcattcacgttctgctctgctctanttanac tcgagctgcgcgtancacacaccctggatcttgacatccttgggngcctt ggcgccgaggtcggtgtctgacggctgcacgctctcgaagacnccgatca cctcgccggtctccggcttgctcttggtgacgctgagcgtgatgttgccc gtggaggaggacgcgttcttcacgttctccttggccaactcctcntcgtc tcctctgcctcnggcgggtanngccanggngttgtc
Download
page-top