Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557080
Length 605 bp
Fasta Format > rwhkp19p17
caggtttttgtccatagggtagatatagcagatcgcatcagatgctagat atccattaatgcctcacaaaatatgaactttaagccacaaagacatctca agggagcatcctagtctactcccagccttgagcagggggttgcaccgcgg cgtcccagccagtagcagccacaacaggagcaggaacggcaccttccaca gcaacaggtgcccctgctgcatcccatccatcgccaccagcaactggagc ttcagccatcggccactcgccaccagtaacaggcgggggagcaggtgcat cagaggtccactggtcaccaccccattgaccagctgcagctccgtaatca gtgatggcagcatactctggggctccagcagcttcatcctcctgctcctt ggcttcctcagggtccctgtagaagaacagatcaaccatgacatcccact tgtgcccaggcaggatagtacccctcatctgcagaaccatcctggccaag agccagtacaggcagccaatgctgttcctccccttgttgtttgctgggat gccgatatcgacgtatcgcatgggagagtcagtgtcacagaaggcaatgg taggg
Download
page-top