Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557012
Length 577 bp
Fasta Format > rwhkp19l21
gtgtgcagcgatanggtaggcaatggagccactaaggccctttgctaagt aacaactacaaaattccaataacataagaaaccacgacacaagcgcctac tgcaggaccctccctctggcttatatgatgccgatcttgttggccacgtc aagagcatcgtagtctggtgtcagcttcacgtacgccttcttcttgccat caggcctgatgagggtgttaaccttcttggcctgaatgtcatacattttc ttgacagcagcctttattttcttcttgtcggccttgaggtcgacaatgaa gacaagggtgttgttgtcttcaatcttcttcatcgcagactcantggtaa gcgggtacttgaggatctggtactggtctaatttgttccttccaggggtg ctgatcctggggtacttggggtccctggccttggacagggtcttggggcg gtgaaatgtcacanaagngcggatcttctttgccgtcttcttgattgacc cacacttnacngccttggcaaccttggcggcctgggcctnggcatcgccc ttcttggcaacagcaactttgggancc
Download
page-top