Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557000
Length 657 bp
Fasta Format > rwhkp19l09
tgaagtgtgcagcgatatggtaggcaatggagccactaaggccctttgct aagtaacaactacaaaattccaataacataagaaaccacgacacaagcgc ctactgcaggaccctccctctggcttatatgatgccgatcttgttggcca cgtcaagagcatcgtagtctggtgtcagcttcacgtacgccttcttcttg ccatcaggcctgatgagggtgttaaccttcttggcctgaatgtcatacat tttcttgacagcagcctttattttcttcttgtcggccttgaggtcgacaa tgaagacaagggtgttgttgtcttcaatcttcttcatcgcagactcagtg gtaagcgggtacttgaggatctggtactggtctaatttgttccttccagg ggtgctgatcctggggtacttggggtccctggccttggacagggtcttgg ggcggtgaaatgtcacagaagtgcggatcttctttgccgtcttcttgatt gacccanacttcacagccttggcaaccttggcggcctgggccttggcatc gcccttcttggcaacagcaactttgggagccatttgagcttctcanaaaa gcctcttgaacttaccttcctggggtgcgggcgcgaggcgatgcnaanac ggctgan
Download
page-top