Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556788
Length 758 bp
Fasta Format > rwhkp18p19
gatctcgtccattggatggtattcgggggttgtgccgaagaagaagatat agacctatgaggaattacgtatgcatgctcaagaacctatgttcgtacat acatacacaaaatcatatagaacaaaaggtatgctccggtcagaaagcag agtcgtacagcagagttttggacaaaagtgaagttcacaaaagaccttca tacgagataggccattgtttcaactcgtagtttaggccttgccggactcc tcgcaacccggtggcctaaaggcgatgaagctgacgcactgcacctggcg caggttgtcgaagccgatgacacggacataggcgtcagggtactccttct tgacctcctccacctcgttcagcacctgtgtggcgtcagtgcacccgaac ataggcagcttccacattgtccagtatcggccgtcgtagtacccggggga gctgttgtgctcacggaagacgaagccaaccttgctgaactcgaggcagg gcacccactttgagcggatcaggtagtcgacctgtttcaggagggcctcc gtggataggggtggcaggtaagacagggtctcgaacttcttgatgccctc aattggccacacctgcatgcacctgatccttccgccattgctgacgctgc tgaggctgccgctggagcggcggccgacggggagaccggctgtggacttg ancccctggaagggtgcnacngnggtanccnangaanccatcacngnngg ggccntgg
Download
page-top