Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556787
Length 744 bp
Fasta Format > rwhkp18p18
atatcacacaggttttgtatatgtgtagccggttctagaatttacatatg catgctcgagaacctatgttcgtacatacacacacagaccatatagaatg aaaaatatgctctggtcgtccagcagagtggtggacaaaagttaagttca caaaagaccttcatacataggccattgtttcaactcgtagtttaggcctt gccagactcctcgcaacccggtggcctgaaggcgatgaagctgacgcact gcacctggcgcaggttgtcgaagccgatgacgcggacataggcgtcaggg tactccttcttgacctcctccacctcgttgagcacctgtgtggcgtcggt gcacccgaacataggcagcttccacattgtccagtatcgaccatcgtagt acccgggggagctgttgtgctcacggaaaacgaagccaaccttgctgaac tcgaggcagggcacccacttggagcggatcaagtagtcgacctgcttcag gagggcctccgtggagaggggtggcaagtaagacagggtctcgaacttct tgatgccctcaatcggccacacctgcatgcacctgatccttccgccgttg ctgacgctgccgaggccggcgctgctggagcggcggctgacgggcaggcc cgcggtggacttgagaccctggaagggtgcgacggaggtggccgaggaan ccatcacagtgggggccatggtgttggaggagggaangngcctc
Download
page-top