Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556604
Length 716 bp
Fasta Format > rwhkp18f20
tgtgtagccggttctagaatttacatatgcatgctcgagaacctatgttc gtacatacacacacagaccatatagaatgaaaaatatgctctggtcgtcc agcagagtggtggacaaaagttaagttcacaaaagaccttcatacatagg ccattgtttcaactcgtagtttaggccttgccagactcctcgcaacccgg tggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttgtcga agccgatgacgcggacataggcgtcagggtactccttcttgacctcctcc acctcgttgagcacctgtgtggcgtcggtgcacccgaacataggcagctt ccacattgtccagtatcgaccatcgtagtacccgggggagctgttgtgct cacggaaaacgaagccaaccttgctgaactcgaggcagggcacccacttg gagcggatcaagtagtcgacctgcttcaggagggcctccgtggagagggg tggcaagtaagacagggtctcgaacttcttgatgccctcaatcggccaca cctgcatgcacctgatccttccgccgttgctgacgctgccgaggccggcg ctgctggagcggcggctgacgggcaggcccgcggtggacttgagaccctg gaagggtgcgacggaggtggccgaggaagccatcacagtgggggccatgg tgttggangagggaan
Download
page-top