Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556252
Length 702 bp
Fasta Format > rwhkp17c13
atttacacgctacggnacattcgtactctcatacttttccccggtaaaat tcacacagtcacatggatgctgcatcgcgcgcatcgcacgcagctgatcc atcaacagccgacggcggcggacgggcaatcaacggccagctcacaggct gggcaccctctcngcggcgccgganatgacggtgagcaggttgttgccga aggggtcgctgaggtgcgcgcacaggttctcaaaggggccctcgccggtg acgtangcctggatgaagaagcccagcatggagaacatggccagccgtcc gttcttgatctccttcaccttgancancgccgcctggtcggggtcggtgg cgaggccgagcgggtcgaatgggccaccggggtggagcttgtcatcaaat tccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgac ctcggcgacgacggcgaggatcaggttgatggggatgctgttgccgaagt anttgagggtgttgccgtcaagganaanggcgccagtcttgaaccaaacn gcctcnggaccncantttgcnccnaacttgttgancgcctcnnngatnat naatccngnngcnccnancatgnnccanctgnnatgnatnanctcanang nctgnnacttnnnnaannnntntnnnttcttnnnnnnannnnnnngatnn ta
Download
page-top