Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556251
Length 623 bp
Fasta Format > rwhkp17c12
tcattgtggcagacgcagcaaaccacctanagctaatagtttattcagag agcaatagcctggccggctgcttcacagtaaccaaacgacaaactgacag tcagaacaaattccacagatggaatagcgacagcaaatcatgtcttcact cgcacagcaccgcgccctcttccagagaatcctcctccgcccgccatgcg aggaggttggcgagcttgccttccttgaccagagggtggctgtgcacact ctcggcctcgaagcagtggaagacggacctgggcgacccggcagagacag caacctcttcgttcacggtaaagctctggtagatgaggacgcctccacag gggagctcctgctccacaacgttgttgcagtcgtatgcctcggcgtcgag cttcttgccccaggtggcggcgtggccgcggccaccaaagatggtgaccg cngcagagaactctgaagggncaaagcaccggaggaccctcttgacnatg tcaccgtatgccagggcggaggcgtccatgcccatgacctcgtaactcnc atagactgaanccgtcctcgggggtcacatggatggtggagacggcanat ccgttgatggcgttcatggagta
Download
page-top