Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556222
Length 872 bp
Fasta Format > rwhkp17a23
catcaaacatgcatcccgggtagcaaaataaccatgtgttatactgccat ctcataacttaacttggaaggctagtgcagttcatacagcatgaagctgc cttcaaatgaaactatgagtacatgatatatcgtgtacctcccttttttg ggaattatgcatatttcaggaataatttggatgatagtgcaaacttcata caaatatcatgtctcatgagctatgataaggcgtgggtttgtaatcatct gcttagaaactggcatcctctgttgtcggcctcctcaagaaataacgcaa gctattcgcgagaacctgttgcaaagccttgattaatggcttgccccggt aactgacatggaattttgccttggccagtagcccctcagtgtcaaattct ccagattggacagtgatattgatgtcagcaatgatcttaactagatcaac caacaaccctggacggtcagctgattccacaacaagtaaacttctttcag gaccatcgtcatagatctctatgtgagttgctatgtccacatcaaccact tccgtagggggctctagcccaaaagttgcacccatggccaattgactgct agcttcaggatgatactcaagcatgttgttaataattgtcagtcttactg cttctaacaactctgggtcatcaattttgcgaccagttgacgactttgtt atagcgaacttattgtgcttgccagaagaatcgaggcaaacactagcttt cacaacatttagccctaaattcctcaaggcactcatagtatcaagaagat cccccaagacggtcacccaagggttacttccacaaatagttgcatccggg atctgagtccttgnatctatta
Download
page-top