Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556213
Length 769 bp
Fasta Format > rwhkp17a12
gcttttccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcagagagcaatagcctggccggctgcttcacagta accaaacgacaaactgacagtcagaacaaattccacagatggaatagcga cagcaaatcatgtcttcactcgcacagcaccgcgccctcttccagagaat cctcctccgcccgccatgcgaggaggttggcgagcttgccttccttgacc agagggtggctgtgcacactctcggcctcgaagcagtggaagacggacct gggcgacccggcagagacagcaacctcttcgttcacggtaaagctctggt agatgaggacgcctccacaggggagctcctgctccacaacgttgttgcag tcgtatgcctcggcgtcgagcttcttgccccaggtggcggcgtggccgcg gccaccaaagatggtgaccgccgcagagaactctgaagggccaaagcacc ggaggaccctcttgacgatgtcgccgtaggccagggcggaggcgtccatg cccatgacctcgtanctcgcatagctgaagccgtcctcgggggtcacatg gatggtggagacggcanatccgttgatggcgttcntggantanccgcang gctcnaantcnaantcncanacctccatctcngnaatgatgtcnganata ncnnanannttgnnnntctccttnnnncnngaannntgnntatnnnnttn antnttnanaanannnang
Download
page-top