Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ556094
Length 214 bp
Fasta Format > rwhkp16j17
anacaactcatgagtccnctcaaagggtgaaggaacaaccaaacatcaat acaacaggtgtggcctgccatgcagagctggccggacgtaggtactcctc tcgctgatcacncnntganataatatgagagcacttattcatatatatgn atatgtatgtgtatgacctcancgtactcngcgtacatcgctgganctat atgcancgatgatg
Download
page-top