Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ555738
Length 663 bp
Fasta Format > rwhkp15h03
tatttacacgtacggcacattcgtactctcatacttttccccggtaaaat tcacacagcacatgatgctgcatcgcgcgcatcgcacgcagctgatccat caacagccgacggcggcggacgggcaatcaacggccagctcacaggctgg gcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaag gggtcgctgaggtgcgcgcacaggttctcaaaggggccctcgccggtgac gtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgt tcttgatctccttcaccttgagcagcgccgcctggtcggggtcggtggcg aggccgagcgggtcgaatgggccaccggggtggagcttgtcatcaaattc cagtccgttggtgatcctgtantactcggcgcctccgacgaggacgacct cggcgacgacggcgaggatcangttgatggggatgctgttgccnaantan ttganggtgttnccntcaanganaangncnccantcttnaaccaaacnnn ctcnnnaccncantttgcnccnaacttnntnancncctnnnnnatnatna ntnnnnnnnnnnnnannatnnnnnnnntnnnntnnatnanntnnnnnnnn tnnnanntnnnna
Download
page-top