Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ555720
Length 367 bp
Fasta Format > rwhkp15g02
tagacagatctcgtccattggatgtattcgggggttgtgccgaagaagaa gatatagacctatgaggaattacgtatgcatgctcaagaacctatgttcg tacatacatacacaaaatcatatagaacaaaaggtatgctccggtcagaa agcagagtcgtacagcagagttttggacaaaagtgaagttcacaaaagac cttcatacgagataggccattgtttcaactcgtagtttaggccttgccgg actcctcgcaacccggtggcctaaaggcgatgaagctgacgcactgcacc tggcgcaggttgtcgaagccgatgacacggacataggcgtcagggtactc cttcttgacctcctcca
Download
page-top