Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ555712
Length 660 bp
Fasta Format > rwhkp15f16
tgctcgagaacctatggttcgtacatacacacacagaccatatagaatga aaaatatgctctggtcgtccagcagagtggtggacaaaagttaagttcac aaaagaccttcatacataggccattgtttcaactcgtagtttaggccttg ccagactcctcgcaacccggtggcctgaaggcgatgaagctgacgcactg cacctggcgcaggttgtcgaagccgatgacgcggacataggcgtcagggt actccttcttgacctcctccacctcgttgagcacctgtgtggcgtcggtg cacccgaacataggcagcttccacattgtccagtatcgaccatcgtagta cccgggggagctgttgtgctcacggaaaacgaagccaaccttgctgaact cgaggcagggcacccacttggagcggatcaagtagtcgacctgcttcagg agggcctccgtggagaggggtggcaagtaagacagggtctcgaacttctt gatgccctcaatcggccacacctgcatgcacctgatccttccgccgttgc tgacgctgccgaggccggcgctgctggagcggcggctgacgggcaggccc gcggtggacttgagaccctggaangtgcgacggaggtggccgaggaagcc atcacagtgg
Download
page-top