Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ555449
Length 628 bp
Fasta Format > rwhkp14g13
cattattgttgggagaaaatacatatagaaaaagagtagagcccagagcc aatgtacgtagcatttaaatggcgtgtcgcagcacccatggtcaagctag ttttaggagaattataaccctcacggcaaatgtcgcagcacgcgtgatca agctagtcttaggagaattttagccctcacaacaataagctcacacatat acactatattcttcactgcattgattttgtaggctacagccttgatgcta aaccaccacccagcttctgcagacacttctggtcaacctcttgaggtgac atgatcagaatggacttgatgctgatcacaaactcctcccatgggccatc accgagaagtaggaagtcaccctcatcatcctggtagagacacgtccaac ctttagtctgtcgttcttcgagttgcccttcgataccaaacatgtgggcc aaagcttgattcaattctccgtatccagagaacctaccgatgtcaatgga gcggcttataaccccacgtttgtgcaccttaatgaatggcatcctctggc gaaggggcaaggcaccaagaatttctgaccacgggcgggcggagattcgg ctgccgagcagaacagagcagaaggcgg
Download
page-top