Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ555224
Length 744 bp
Fasta Format > rwhkp13k15
gcttttccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcagagagcaatagcctggccggctgcttcacagta accaaacgacaaactgacagtcagaacaaattccacagatggaatagcga cagcaaatcatgtcttcactcgcacagcaccgcgccctcttccagagaat cctcctccgcccgccatgcgaggaggttggcgagcttgccttccttgacc agagggtggctgtgcacactctcggcctcgaagcagtggaagacggacct gggcgacccggcagagacagcaacctcttcgttcacggtaaagctctggt agatgaggacgcctccacaggggagctcctgctccacaacgttgttgcag tcgtatgcctcggcgtcgagcttcttgccccaggtggcggcgtggccgcg gccaccaaagatggtgaccgccgcagagaactctgaagggccaaagcacc ggaggaccctcttgacgatgtcgccgtangccagggcggaggcgtccatg cccatgacctcgtagctcgcatanctgaagccgtcctcgggggtcacatg gatggtggagacggcanatccgttgatggcgttcatggantanccncang gctcnaantcnaantcnnnnacctccatctcnggaatgatgtnnnanata nnnnanancttggncatctcctttggnnnnngaaanntggntat
Download
page-top