Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559713
Length 754 bp
Fasta Format > rwhkp9c24
gatgatgaacaattcgccactcagtttacaatacacaccgacaaccgcct caaaaaccaccaaatcaaagggatgagcacatggcgccgcgccgcgccga gaaacaaactagcctaaccaacaggtggatacagagacccagattattca aagtaaacacggctatggtggcgacatcctccttgcaattaaaatggggg agctgctatacggcttactgcgccttggcgagctcggcgcggatctgctt ggcggcctcgaccatgttggtgagggcgggcttgacctcggcgtacttgc gggtcttgagaccgcagtcggggttcacccacaggatgttggtatcgagc accgcgagcatcttgttgacacggtcggcgatctcctccttggacgggat cctgggggagtggatgtcgtacacgcccgggccaatgccggcgccgtaca ccacgccctcgcggaagacggagagaagcttctcgtcggaccgcgagttc tcgatggtgatcacatcggcgtccatgttgatgatggactggatgatgtc gttgaagttggagtagcacatgtgggtgtggatctgggtggtgtcctgga caccncanntggngatcctnaangantgcncngnccnntnnannnanaaa nnnngntccnanttnnnnanngnnnnannctctntnnnnnnnncntnntn nanttnnatnnnntnaatannnnnnnnntnnnngnnntcnanctncttnt tnat
Download
page-top