Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559599
Length 562 bp
Fasta Format > rwhkp8m21
acatggtccgcgtgtttgtatataataaatatcacacaggttttgtatat gtgtagccggttctagaatttacatatgcatgctcgagaacctatgttcg tacatacacacacagaccatatagaatgaaaaatatgctctggtcgtcca gcagagtggtggacaaaagttaagttcacaaaanaccttcatacataggc cattgtttcaactcgtagtttaggccttgccagactcctcgcaacccggt ggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttgtcgaa gccgatgacgcggacataggcgtcagggtactccttcttgacctcctcca cctcgttgagcacctgtgtggcgtcggtgcacccgaacataggcagcttc cacattgtccagtatcgaccatcgtagtacccgggggagctgttgtgctc acggaaaacgaagccaaccttgctgaactcgaggcagggcacccacttgg agcggatcaagtagtcgacctgcttcaggagggcctccgtggagaggggt ggcaagtaagac
Download
page-top