Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559547
Length 748 bp
Fasta Format > rwhkp8k02
aatatcacacaggttttgtatatgtgtagccggttctagaatttacatat gcatgctcgagaacctatgttcgtacatacacacacagaccatatagaat gaaaaatatgctctggtcgtccagcagagtggtggacaaaagttaagttc acaaaagaccttcatacataggccattgtttcaactcgtagtttaggcct tgccagactcctcgcaacccggtggcctgaaggcgatgaagctgacgcac tgcacctggcgcaggttgtcgaagccgatgacgcggacataggcgtcagg gtactccttcttgacctcctccacctcgttgagcacctgtgtggcgtcgg tgcacccgaacataggcagcttccacattgtccagtatcgaccatcgtag tacccgggggagctgttgtgctcacggaaaacgaagccaaccttgctgaa ctcgaggcagggcacccacttggagcggatcaagtagtcgacctgcttca ggagggcctccgtggagaggggtggcaagtaagacagggtctcgaacttc ttgatgccctcaatcggccacacctgcatgcacctgatccttccgccgtt gctgacgctgccgaggccggcgctgctggagcggcggctgacgggcaggc ccgcggtggacttgagaccctggaagggtgcgacggaggtggccgaggaa gccatcacagtgggggccatggtgttggaggagggaagcggnacnang
Download
page-top