Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559428
Length 566 bp
Fasta Format > rwhkp8d02
gcttttccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcagagagcaatagcctggccggctgcttcacagta accaaacgacaaactgacagtcagaacaaattccacagatggaatagcga cagcaaatcatgtcttcactcgcacagcaccgcgccctcttccagagaat cctcctccgcccgccatgcgaggaggttggcgagcttgccttccttgacc agagggtggctgtgcacactctcggcctcgaagcagtggaagacggacct gggcgacccggcagagacagcaacctcttcgttcacggtaaagctctggt agatgaggacgcctccacaggggagctcctgctccacaacgttgttgcag tcgtatgcctcggcgtcgagcttcttgccccaggtggcggcgtggccgcg gccaccaaagatggtgaccgccgcagagaactctgaagggccaaagcacc ggaggaccctcttgacgatgtcgccgtaggccagggcggaggcgtccatg cccatgacctcgtagc
Download
page-top