Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559425
Length 658 bp
Fasta Format > rwhkp8c23
ataacagaagctaaaatataaaccgacaccctgggtttagattactagat acacacacaaacacacattgttgcctcgattgtttcctctccaccgatca acccacgtacgcatgcacacaagatgagtatcttcacttctgctctgctc tagttagactcgagctgcgcgtaccacacaccctggatcttgacatcctt gggcgccttggcgccgaggtcggtgtctgacggctgcacgctctcgaaga cgccgatcacctcgccggtctccggcttgctcttggtgacgctgagcgtg atgttgcccgtggaggaggacgcgttcttcacgttctccttggccaactc ctcctcgtctcctctgcctccggcgggtagcgccacggcgttgtcgtagc cagtagagccaccacggccctttgggtcgaggaaagacgaacccctgtag ctgggcacgaggaagggcccgctgaagctctcgggcttgccggtggcgac gagctgcttgacggtgaagaggaagggcacgcgctcgcctccggggagct gcacggtgacggccgcgtagtcgatgccgtccttctcctcgaacttgagg gtgccgtcggcgccgacctcgagcgggccttccatctcgtcaagggtgta ngtgagac
Download
page-top